(102f) Analysis of Exponential Amplification Reaction (EXPAR) Termination and Overcoming with Looped Templates

Analysis
of Exponential Amplification Reaction (EXPAR) Termination and Overcoming with
Looped Templates

Burcu Özay and Stephanie
E McCalla

Department of Chemical & Biological Engineering, Montana State
University, Bozeman, MT

Introduction: Isothermal
amplification reactions have begun to compete with the gold standard polymerase
chain reaction (PCR) due to their simplicity and speed. PCR is a broadly used
DNA amplification reaction due to its robust, well characterized amplification
mechanism. The temperature cycling requirement of PCR requires extra time,
energy, and specialized equipment. Recently, emerging isothermal DNA
amplification reactions have begun to compete with PCR due to their speed,
simplicity and low energy requirements. Isothermal reactions can proceed at a
single low temperature, typically 32 - 65°C, which can be attained without
electricity and reduces assay complexity. These reactions are promising for
diagnostics in limited resource settings, where the number of highly-trained personnel
is scarce.

One
increasingly popular method involves the simultaneous use of a nicking
endonuclease and a polymerase with strand-displacement capabilities.  The nicking endonuclease can nick one strand
of a double stranded DNA molecule, and the polymerase can extend at this nick
while displacing the downstream DNA strand. 
This is the mechanism that drives a lot of isothermal amplification
reactions including exponential amplification of oligonucleotides (EXPAR) where
EXPAR is the most popular amongst these methods.  During an EXPAR reaction, a short single
stranded DNA or RNA target binds to a single stranded DNA template containing a
recognition site for a nicking endonuclease. This target molecule then acts as
a primer and is extended by a DNA polymerase upon hybridization on an EXPAR
template. One strand of the double stranded template is cut at the recognition
site by the nicking endonuclease, allowing extension by the polymerase and
freeing the top strand of the template downstream of the nick (Figure 1a).
If this newly freed DNA strand is identical to the target molecule, it will
bind another template and exponentially amplify.  For low concentrations of target, the target
molecule can amplify 10^6-10^8 fold in a few minutes [1].

EXPAR
undergoes early termination after a template molecule was cyclically nicked and
extended on the order of ten times; this phenomenon was originally attributed
to enzyme exhaustion. Recently we discovered that palindromic looped templates can
restart in a second phase after this original termination and produce 10-100 times
more DNA product with the same concentrations of starting materials, which
disproves enzyme exhaustion theory [2]. This reaction is called ultrasensitive
DNA amplification reaction (UDAR) because of its unique switch-like behavior (Figure
1b&2).

One
group suggested that EXPAR templates could become “poisoned” during a reaction
due to polymerase error, however they did not study the mechanism behind it
[3].

We
aim to determine the mechanism of early termination during EXPAR and to discuss
the mechanisms that allow UDAR to overcome this early termination.

In
this work; we investigate that hypothesis that the EXPAR early termination is
due to template poisoning caused by polymerase errors that render nickase
unable to free the trigger oligonucleotide, leaving the EXPAR template
double-stranded and unavailable for amplification. This hypothesis is supported
by showing that addition of fresh template after the reaction reaches a plateau
can recover the reaction from this stall, and that the addition of isolated poisonous
template top strands from reaction products inhibits EXPAR amplification. UDAR
is demonstrated as a method to overcome EXPAR termination, resulting in 10-100
times higher product concentrations.  The
resulting ample fluorescence increase between the start and end points of the
reaction eliminates the need for a specialized imaging device to monitor
reaction output.

Materials & Methods:
EXPAR mixture contained 1× ThermoPol I
Buffer, 25 mM Tris-HCl (pH 8), 6 mM MgSO₄, 50 mM KCl, 0.5 mM each
dNTP, 0.1 mg mL−1 BSA, 0.2 U µL−1 Nt·BstNBI, 0.0267 U µL⁻¹
Bst 2.0 WarmStart® DNA Polymerase, 4X SYBR Green II and 100 nM EXPAR1 template
(CTCACGCTACGGACGACTCTCTCACGCTAC/3Phos/). The UDAR mixture contained same
reagents as EXPAR while UDAR exchanged EXPAR template with 100 nM looped UDAR
template LS2 (TCCGGAGAATTAATGACTCTTCCGGAGAAT/3AmMO/). Fluorescence readings were measured to monitor
products every 34 seconds for 150 cycles at 55 °C.  

To
isolate poisoned EXPAR templates, the products of biotinylated EXPAR1 template
(/5AmMC6/CTCACGCTACGGACGACTCTCTCACGCTACTTTTT/3BioTEG/) mixed with Streptavidin
magnetic beads. The poisonous EXPAR1 top strand is isolated by 10 mM NaOH
treatment for 10 minutes and purified by PAGE recovery. The concentration of
isolated poisonous top strand was measured by fluorophotometer using 1X SYBR
Gold.

Results
and Discussion: EXPAR was performed with varying initial
template concentrations and the reaction was paused at the beginning of the
plateau phase to either add fresh EXPAR templates, control oligos or
nuclease-free water to the samples. The results showed that the addition of
fresh template produced another short exponential phase followed by a second
plateau, while addition of water or a control oligo did not. This shows that
the EXPAR termination is not due to the depletion of reaction reagents and supports
the theory of template poisoning by showing the fresh templates save the
reaction (Figure 3).

The
poisonous top strand was isolated and used as an additive to EXPAR which
resulted in lack of amplification while the control samples showed no
inhibition. This experiment strongly supports the template poisoning
hypothesis by showing that the addition of this top strand to a fresh reaction
mix inhibits EXPAR (Figure 4).

To
overcome EXPAR termination, the linear template of EXPAR is replaced with a
looped template (UDAR template) that contains a palindromic region.  The palindrome and looped structure rescue
the reaction from termination by allowing displacement of the poisonous top
strand, resulting in higher product yields (Figure 1&2). Also, the
switch-like, ultrasensitive behavior of UDAR makes it a suitable for
biosensors, DNA computing and synthetic biology applications.

Conclusions:
EXPAR
is a popular isothermal DNA amplification reaction which can be used to detect
various molecules such as DNA, RNA, miRNA or proteins. However, the EXPAR
mechanism has not been fully characterized. In this work, we have shown that
the early termination of EXPAR is not due to the depletion of reaction
reagents; the termination is caused by template poisoning, likely due to
polymerase errors. Moreover, a novel isothermal DNA amplification reaction
mechanism (UDAR) is shown, which overcomes the EXPAR termination by replacing
the linear EXPAR template with a looped one. Understanding the mechanisms
driving isothermal DNA amplification reactions is important when engineering
isothermal amplification schemes, particularly when creating molecular
recognition systems that are faster, more robust, sensitive, and specific. This
work contributes to synthetic biology applications such as biosensors, DNA
circuits and clinical diagnostics.

Acknowledgments: This
work was supported by the Office of the Assistant Secretary of Defense for
Health Affairs, through the Peer Reviewed Medical Research Program, Discovery
Award under Award No. W81XWH-17-1-0319. Opinions, interpretations, conclusions
and recommendations are those of the authors and are not necessarily endorsed
by the Department of Defense.

References:
[1] Van Ness et al., PNAS,
2003, pp. 4504-4509. [2] Özay et al., Analyst, 2018, pp.
1820-1828. [3] Baccoucheab et al., Methods, 2014, pp. 234-249.